5KTJ - JenaLib

Title :   CRYSTAL STRUCTURE OF PISTOL, A CLASS OF SELF-CLEAVING RIBOZYME

Authors :   L. A. Nguyen, J. Wang, T. A. Steitz

Date :   11 Jul 16 (Deposition) - 05 Oct 16 (Release) - 15 Feb 17 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.97

Chains :   Asym. Unit : A,B,C,D
Biol. Unit 1: A,B  (1x)
Biol. Unit 2: C,D  (1x)

Keywords :   Ribozyme, Self-Cleavage, Internal Transesterification, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   L. A. Nguyen, J. Wang, T. A. Steitz
Crystal Structure Of Pistol, A Class Of Self-Cleaving Ribozyme.
Proc. Natl. Acad. Sci. V. 114 1021 2017 U. S. A.
PubMed-ID: 28096403 | Reference-DOI: 10.1073/PNAS.1611191114

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (4, 41)

Asymmetric Unit (4, 41)

No.	Name	Count	Type	Full Name
1	ATP	2	Mod. Nucleotide	ADENOSINE-5'-TRIPHOSPHATE
2	MG	19	Ligand/Ion	MAGNESIUM ION
3	NCO	10	Ligand/Ion	COBALT HEXAMMINE(III)
4	SM	10	Ligand/Ion	SAMARIUM (III) ION

Biological Unit 1 (2, 7)

No.	Name	Count	Type	Full Name
1	ATP	1	Mod. Nucleotide	ADENOSINE-5'-TRIPHOSPHATE
2	MG	-1	Ligand/Ion	MAGNESIUM ION
3	NCO	6	Ligand/Ion	COBALT HEXAMMINE(III)
4	SM	-1	Ligand/Ion	SAMARIUM (III) ION

Biological Unit 2 (2, 5)

No.	Name	Count	Type	Full Name
1	ATP	1	Mod. Nucleotide	ADENOSINE-5'-TRIPHOSPHATE
2	MG	-1	Ligand/Ion	MAGNESIUM ION
3	NCO	4	Ligand/Ion	COBALT HEXAMMINE(III)
4	SM	-1	Ligand/Ion	SAMARIUM (III) ION

Sites (37, 37)

Asymmetric Unit (37, 37)

No.	Name	Evidence	Residues	Description
01	AC1	SOFTWARE	C A:41 , G A:42 , HOH A:205 , HOH A:212	binding site for residue SM A 101
02	AC2	SOFTWARE	C A:22 , A A:23 , G C:50	binding site for residue SM A 102
03	AC3	SOFTWARE	G A:32 , SM C:102	binding site for residue SM A 103
04	AC4	SOFTWARE	U C:30	binding site for residue SM A 104
05	AC5	SOFTWARE	U A:18	binding site for residue SM A 105
06	AC6	SOFTWARE	C A:2 , U A:3	binding site for residue MG A 106
07	AC7	SOFTWARE	G A:24	binding site for residue MG A 107
08	AC8	SOFTWARE	U A:6 , G A:33	binding site for residue MG A 109
09	AC9	SOFTWARE	G A:27 , G A:28 , U A:29 , U B:11	binding site for residue NCO A 110
10	AD1	SOFTWARE	A A:49 , G A:50 , U C:30 , G C:32	binding site for residue NCO A 111
11	AD2	SOFTWARE	A A:37 , A A:38 , G A:40 , U B:11 , C B:12	binding site for residue NCO A 112
12	AD3	SOFTWARE	A A:46 , G A:47 , U C:29 , U C:30 , A C:31	binding site for residue NCO A 113
13	AD4	SOFTWARE	A A:14 , G A:15 , U A:16 , A C:14 , G C:15 , U C:16	binding site for residue NCO A 114
14	AD5	SOFTWARE	HOH A:210 , HOH A:213 , HOH B:201 , HOH B:202 , HOH B:203 , HOH D:201	binding site for residue MG A 115
15	AD6	SOFTWARE	HOH A:218 , HOH A:226 , HOH A:228 , HOH A:229 , HOH B:207 , HOH B:208	binding site for residue MG A 116
16	AD7	SOFTWARE	A A:31 , A A:44 , HOH A:201 , HOH A:202 , HOH A:203 , HOH A:207 , HOH D:202 , HOH D:203	binding site for residue MG A 117
17	AD8	SOFTWARE	HOH A:206 , HOH A:214 , HOH A:217 , HOH C:201 , HOH C:213 , HOH C:222	binding site for residue MG A 118
18	AD9	SOFTWARE	HOH A:204 , HOH A:209 , HOH A:220 , HOH A:221 , HOH A:223 , HOH A:227	binding site for residue MG A 119
19	AE1	SOFTWARE	G A:40 , C B:9 , G B:10	binding site for residue NCO B 101
20	AE2	SOFTWARE	C C:41 , G C:42 , HOH C:202 , HOH C:204 , HOH C:220	binding site for residue SM C 101
21	AE3	SOFTWARE	SM A:103 , G C:50	binding site for residue SM C 102
22	AE4	SOFTWARE	A A:31 , C D:13	binding site for residue SM C 103
23	AE5	SOFTWARE	A C:31	binding site for residue MG C 105
24	AE6	SOFTWARE	A C:44	binding site for residue MG C 106
25	AE7	SOFTWARE	G C:47	binding site for residue MG C 107
26	AE8	SOFTWARE	G C:33	binding site for residue MG C 108
27	AE9	SOFTWARE	A C:37 , A C:38 , G C:40 , U D:11 , C D:12	binding site for residue NCO C 109
28	AF1	SOFTWARE	C A:48 , A A:49 , U C:29	binding site for residue NCO C 110
29	AF2	SOFTWARE	G C:27 , G C:28 , U C:29 , U D:11	binding site for residue NCO C 111
30	AF3	SOFTWARE	HOH C:207 , HOH C:212 , HOH C:215 , HOH C:217 , HOH C:228 , HOH C:232	binding site for residue MG C 112
31	AF4	SOFTWARE	HOH C:209 , HOH C:218 , HOH C:229 , HOH C:231 , HOH C:233 , HOH D:210	binding site for residue MG C 113
32	AF5	SOFTWARE	HOH A:222 , HOH C:205 , HOH C:211 , HOH C:225 , HOH D:204 , HOH D:206	binding site for residue MG C 114
33	AF6	SOFTWARE	HOH A:208 , HOH B:206 , HOH C:203 , HOH C:226 , HOH D:205 , HOH D:209	binding site for residue MG C 115
34	AF7	SOFTWARE	HOH A:211 , HOH A:215 , HOH A:216 , HOH A:224 , HOH C:214 , HOH C:223	binding site for residue MG C 116
35	AF8	SOFTWARE	HOH A:219 , HOH A:230 , HOH C:208 , HOH C:216 , HOH C:221 , HOH C:224	binding site for residue MG C 117
36	AF9	SOFTWARE	HOH B:205 , A D:15	binding site for residue SM D 101
37	AG1	SOFTWARE	C D:9 , G D:10	binding site for residue NCO D 102

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:50
                                                                                 
                  5ktj A  1 xCUCGUUUGAGCGAGUAUAAACAGUUGGUUAGGCUCAAAGCGGAGAGCAG 50
                            |       10        20        30        40        50
                            |                                                 
                            1-ATP

Chain B from PDB  Type:DNA/RNA  Length:15
                                              
                  5ktj B  1 UCUGCUCUCGUCCAA 15
                                    10

Chain C from PDB  Type:RNA  Length:50
                                                                                 
                  5ktj C  1 xCUCGUUUGAGCGAGUAUAAACAGUUGGUUAGGCUCAAAGCGGAGAGCAG 50
                            |       10        20        30        40        50
                            1-ATP

Chain D from PDB  Type:DNA/RNA  Length:15
                                              
                  5ktj D  1 UCUGCUCUCGUCCAA 15
                                    10

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		ATP	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		MG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		NCO	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		SM	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]
		AC6	[ RasMol ]	+environment [ RasMol ]
		AC7	[ RasMol ]	+environment [ RasMol ]
		AC8	[ RasMol ]	+environment [ RasMol ]
		AC9	[ RasMol ]	+environment [ RasMol ]
		AD1	[ RasMol ]	+environment [ RasMol ]
		AD2	[ RasMol ]	+environment [ RasMol ]
		AD3	[ RasMol ]	+environment [ RasMol ]
		AD4	[ RasMol ]	+environment [ RasMol ]
		AD5	[ RasMol ]	+environment [ RasMol ]
		AD6	[ RasMol ]	+environment [ RasMol ]
		AD7	[ RasMol ]	+environment [ RasMol ]
		AD8	[ RasMol ]	+environment [ RasMol ]
		AD9	[ RasMol ]	+environment [ RasMol ]
		AE1	[ RasMol ]	+environment [ RasMol ]
		AE2	[ RasMol ]	+environment [ RasMol ]
		AE3	[ RasMol ]	+environment [ RasMol ]
		AE4	[ RasMol ]	+environment [ RasMol ]
		AE5	[ RasMol ]	+environment [ RasMol ]
		AE6	[ RasMol ]	+environment [ RasMol ]
		AE7	[ RasMol ]	+environment [ RasMol ]
		AE8	[ RasMol ]	+environment [ RasMol ]
		AE9	[ RasMol ]	+environment [ RasMol ]
		AF1	[ RasMol ]	+environment [ RasMol ]
		AF2	[ RasMol ]	+environment [ RasMol ]
		AF3	[ RasMol ]	+environment [ RasMol ]
		AF4	[ RasMol ]	+environment [ RasMol ]
		AF5	[ RasMol ]	+environment [ RasMol ]
		AF6	[ RasMol ]	+environment [ RasMol ]
		AF7	[ RasMol ]	+environment [ RasMol ]
		AF8	[ RasMol ]	+environment [ RasMol ]
		AF9	[ RasMol ]	+environment [ RasMol ]
		AG1	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5ktj)

Biological Units
	Complete Structure
		Biological Unit 1	[ Jena3D ]
		Biological Unit 2	[ Jena3D ]

Still Images

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	5ktj
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Description