Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  SV40 LARGE T ANTIGEN ORIGIN BINDING DOMAIN BOUND TO ARTIFICIAL DNA FORK
 
Authors :  G. Meinke, A. Bohm, P. A. Bullock
Date :  18 Aug 15  (Deposition) - 09 Sep 15  (Release) - 09 Sep 15  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.70
Chains :  Asym./Biol. Unit :  A,B,X,Y
Keywords :  Origin Binding Domain, Replication, Sv40, Replication-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  G. Meinke, P. J. Phelan, A. Fradet-Turcotte, A. Bohm, J. Archambault, P. A. Bullock
Structure-Based Analysis Of The Interaction Between The Simian Virus 40 T-Antigen Origin Binding Domain And Single-Stranded Dna.
J. Virol. V. 85 818 2011
PubMed-ID: 20980496  |  Reference-DOI: 10.1128/JVI.01738-10

(-) Compounds

Molecule 1 - LARGE T ANTIGEN
    Chains: A, B
    EC Number: 3.6.4.-
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PGEX-1LAMBDAT
    Expression System Strain: BL21
    Expression System Taxid: 511693
    Fragment: UNP RESIDUES 131-260
    Organism Common: SV40
    Organism Scientific: SIMIAN VIRUS 40
    Organism Taxid: 10633
    Synonym: LT-AG
 
Molecule 2 - DNA (5'- D(*GP*AP*GP*GP*AP*GP*GP*CP*TP*TP*TP*TP*TP*TP*GP*GP*AP*GP*GP*CP*C)- 3')
    Chains: X
    Engineered: YES
    Expression System: SYNTHETIC CONSTRUCT
    Expression System Taxid: 32630
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
 
Molecule 3 - DNA (5'- D(*AP*CP*TP*CP*CP*TP*CP*CP*GP*AP*AP*AP*AP*AP*AP*CP*CP*TP*CP*CP*GP*GP* A)-3')
    Chains: Y
    Engineered: YES
    Expression System: SYNTHETIC CONSTRUCT
    Expression System Taxid: 32630
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABXY

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (4, 7)

Asymmetric/Biological Unit (4, 7)
No.NameCountTypeFull Name
1ACT1Ligand/IonACETATE ION
2CA2Ligand/IonCALCIUM ION
3CME2Mod. Amino AcidS,S-(2-HYDROXYETHYL)THIOCYSTEINE
4EDO2Ligand/Ion1,2-ETHANEDIOL

(-) Sites  (5, 5)

Asymmetric Unit (5, 5)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREASN A:209 , ILE A:222 , CYS A:223 , HOH A:413binding site for residue EDO A 301
2AC2SOFTWARELYS B:167 , ALA B:212 , GLN B:213 , CME B:216 , HOH B:433binding site for residue CA B 301
3AC3SOFTWAREASN B:209 , ILE B:222 , CYS B:223 , HOH B:436 , HOH B:438binding site for residue EDO B 302
4AC4SOFTWAREDG X:18 , DG X:19 , HOH X:112 , HOH X:120 , DG Y:22 , HOH Y:201binding site for residue CA Y 101
5AC5SOFTWAREASN B:153 , DA X:17 , DG X:18 , DG Y:22 , HOH Y:201binding site for residue ACT Y 102

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5D9I)

(-) Cis Peptide Bonds  (2, 3)

Asymmetric/Biological Unit
No.Residues
1Asp A:239 -Pro A:240
2Asp B:239 -Pro B:240

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5D9I)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5D9I)

(-) Exons   (0, 0)

(no "Exon" information available for 5D9I)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:133
                                                                                                                                                                     
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhh....hhhhhhhh.........eeeeeeeehhhhhhhhhhhhhhhhh..eeeeeee..eeeeeeeeeeeehhhhhhhhhhhhh....eeeee..hhhhhhhhhh...eeeeee......hhhhhh... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5d9i A 129 GSKVEDPKDFPSELLSFLSHAVFSNRTLACFAIYTTKEKAALLYKKIMEKYSVTFISRHNSYNHNILFFLTPHRHRVSAINNYAQKLcTFSFLICKGVNKEYLMYSALTRDPFSVIEESLPGGLKEHDFNPES 261
                                   138       148       158       168       178       188       198       208       218       228       238       248       258   
                                                                                                                 216-CME                                         


Chain B from PDB  Type:PROTEIN  Length:132
                                                                                                                                                                    
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author .hhhhh....hhhhhhhh........eeeeeeeeehhhhhhhhhhhhhhhhh..eeeeeee..eeeeeeeeeeeeehhhhhhhhhhhh....eeeee..hhhhhhhhhh...eeeeee......hhhhhh.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 5d9i B 129 GSKVEDPKDFPSELLSFLSHAVFSNRTLACFAIYTTKEKAALLYKKIMEKYSVTFISRHNSYNHNILFFLTPHRHRVSAINNYAQKLcTFSFLICKGVNKEYLMYSALTRDPFSVIEESLPGGLKEHDFNPE 260
                                   138       148       158       168       178       188       198       208       218       228       238       248       258  
                                                                                                                 216-CME                                        


Chain X from PDB  Type:DNA  Length:21
                                                     
                 5d9i X   1 GAGGAGGCTTTTTTGGAGGCC  21
                                    10        20 


Chain Y from PDB  Type:DNA  Length:23
                                                       
                 5d9i Y   1 ACTCCTCCGAAAAAACCTCCGGA  23
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5D9I)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5D9I)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5D9I)

(-) Gene Ontology  (26, 26)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ACT  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CME  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Asp A:239 - Pro A:240   [ RasMol ]  
    Asp B:239 - Pro B:240   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5d9i
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  LT_SV40 | P03070
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.6.4.-
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  LT_SV40 | P03070
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        LT_SV40 | P03070: 1ejl 1gh6 1n25 1q1s 1q1t 1svl 1svm 1svo 1tbd 1z1d 2fuf 2h1l 2if9 2ipr 2itj 2itl 2nl8 2ntc 2tbd 3qk2 3qn2 4e2i 4fgn 4gdf 4rxh 5tct

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5D9I)